help  | about  | cite  | software

Allele : 53366 Homo sapiens

Alternate  T Clinical Significance  Pathogenic
Reference  TCCAGGACCCCCAGGACCTCCAGGACCCC Type  deletion

Publication Counts Displayer

1 Data Sets

1 Diseases

1 Gene

0 Genotypes

0 High Level Phenotype Terms

0 Publication

1 Sequence Ontology Term